AlexBeWare3356 AlexBeWare3356
  • 02-10-2017
  • Physics
contestada

What device changes kinetic energy into electrical energy?

Respuesta :

josh09132
josh09132 josh09132
  • 04-10-2017
A. an electric generator
Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
El clima de la costa Guatemalteca es tropical, es decir es ______________________.
Fractures of the blank of long bones are especially common in young animals
difference between syntax and semantics
What is the value of x?
the spread use of chop sticks into southeast asian countries with the influx of chinese migrants there is an example of which of the following concepts A. Stim
What did lamarck contribute to the theory of evolution? 101. explain the information that influenced darwin's view of natural selection/ evolution. 102. define
What was the result of the anti-nephi-lehies becoming converted unto the lord?
Which statement is true about nonfiction? Question 1 options: Nonfiction can contain facts, opinions, and ideas. Nonfiction deals with imaginary people and made
what is 3(2x-4)=5x+2