kaidyn1 kaidyn1
  • 02-02-2017
  • Mathematics
contestada

Ben rolls two number cubes what is the probity that the sum of the number she rolls less than six

Respuesta :

Аноним Аноним
  • 08-02-2017
That would be: how many rolls add up to 2,3,4,5? 
There are 36 possible rolls.
Answer Link

Otras preguntas

Graph the six terms of a finite series where a1 = -3 and r = 1.5.
What were the driving forces behind the industrial revolution
How much money, in dollars, does one mole of nickels represent?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How do you put allele in a sentence
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
what was NOT a primary goal of marriage in a feudal system at the noble level? A. Exchange of land and goods B. love and companionship C. Political arrangement
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?