junistaken1
junistaken1 junistaken1
  • 02-10-2021
  • Mathematics
contestada

Help me pls help me do 77

Help me pls help me do 77 class=

Respuesta :

4mr6xr2qy5 4mr6xr2qy5
  • 02-10-2021

Answer:

5

Step-by-step explanation:

since the lengh of OP is 5

Answer Link

Otras preguntas

help pleaseeee i’ll give a brainliest to the person with the correct answer
Find the slope of the line with these two points: (2,5) and (4, 10).
Whatcha of the following is an example of a reaction of fear
In the story "The Yellow Wallpaper," why does the author use more symbols? at least 50 words minimum
Brainliest Solve the system using elimination. 2x – 2y = –8 x + 2y = –1 (–3, 1) (1, 5) (–14, 1) (0, 4)
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
What major economic practice began during the Middle Ages?
A 34-inch piece of wood is 2.4% of a longer piece of wood. How long is the longer piece of wood? Show your work. You can use proportions
How do you line up 17.5x2.48
A machine with a mechanical advantage of 10 is used to produce an output force of 250 Newton’s. What input force is applied to this machine