lhargett67 lhargett67
  • 03-12-2020
  • Mathematics
contestada

6 people go to restaurant they arrived randomly at different times in how many ways can they arrive

Respuesta :

Katturi123 Katturi123
  • 03-12-2020

Answer:

6

Step-by-step explanation:

Answer Link
Аноним Аноним
  • 03-12-2020

Answer:

yeah 6 times.

Step-by-step explanation:

Answer Link

Otras preguntas

what are the zeros of the polynomial x2+4x-12
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What is the interquartile range of the data? 17, 18, 18, 20, 23, 25, 27, 27, 34, 38, 40, 46, 46, 62, 67
PLSSSSSS HELP 30PTSSSSSS!!!!!!!!!!!!!
Help with geometry!!!
What will be the value in twenty years of $1000 invested at the end of each year for the next twenty years?
a food worker prepares a raw fish fillet for cooking. what food hazard must be removed during preparation?
What is the distance between points (-42, 63) and (-39, 67)?
Application of force with movement is called _______________ exercise.
__________ is widely considered to be the founder of the professional american police department.