05nmoreno 05nmoreno
  • 03-11-2020
  • Mathematics
contestada

HEEEEELPPP what is the answeeerrr

(5x)^2

Respuesta :

Smilex Smilex
  • 03-11-2020

Simplified the expression.

Answer:

25x²

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The right to a trial by jury in a criminal case is outlined in which amendment?
Find the parabola with equation y = ax2 + bx whose tangent line at (3, 12) has equation y = 10x − 18. y = incorrect: your answer is incorrect.
The degree measure of angle a is 135°. which expression below is equivalent to the radian measure of angle a?
PLSSSSSS HELP 30PTSSSSSS!!!!!!!!!!!!!
There is no universally agreed-upon definition of cultural competence.
The _____________________ solved the most difficult problem of the convention, including how the states would be represented in the new congress.
the value x+x(x×) when x = 2
HELP NEEDED !!!! A class's exam scores are normally distributed. If the average score is 65 and the standard deviation is 6, what percentage of students scored
A fitness contract is a/an A. evaluation of strength, flexibility, endurance, and proper nutrition. B. written document stating an individual's