01-07-2020
Mathematics

contestada

Solve for x in the triangle. Round your answer to the nearest tenth.

Solve for x in the triangle Round your answer to the nearest tenth class=

Respuesta :

01-07-2020

Answer:

x ≈ 6.9

Step-by-step explanation:

We use tan∅ to solve this:

tan21° = x/18

18(tan21°) = x

x = 6.90955

Answer Link

Otras preguntas

EASY THEATRE QUESTION WILL GIVE BRAINLIEST (TRUE OR FALSE) The orchestra pit is typically located between the back of the house and the last row of orchestra se

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

plz help 7x^2 - 6(x + 3)

what is the main reason for using a data table

Please help I am dying from this question Will mark brainiest if answer is given

HELPPPPPPPP MEEEEEEE

How were the practices of sharecropping and slavery similar? O Sharecropping and slavery provided social mobility. O Sharecropping was protected by the U.S. Con

A Law Firm charges $1,200 for an initial consultation and then $180 per hour of work. Which expression can be used to determine the cost of hiring the firm for

How was Sumerian society organized

Change Hee bought 8.2 pounds of coffee that cost $6.85 per pound. How much did he spend on coffee?