kenlieehalstead kenlieehalstead
  • 02-10-2019
  • History
contestada

why was selim’s capture of mecca, medina, and cairo so significant

Respuesta :

dimaalbaghli dimaalbaghli
  • 02-10-2019

Answer:selim made the ottoman empire much more important in thr muslim world,gained access to pilgrimage and trade routes,and demonstrated the strength and influence of the ottoman empire.

Answer Link

Otras preguntas

the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
How has water influenced the development of civilization in Africa
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
the perimeter of a square 116ft ?
2ln(5x)=8 solve for x
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
who was the founder of Pennsylvania?